Journal: bioRxiv

Article Title: A paradigm for regulation at the effector interface with RNA-binding proteins

doi: 10.1101/2023.09.20.558714

Figure Lengend Snippet: (A) Inducible system for UNK-driven cell morphogenesis. Shown is an all-in-one variant of the previously reported system used in this study (Methods) , . (B) HeLa cells are incubated with doxycycline (Dox) for 48 hours after which the morphology of GFP-expressing cells is evaluated (Methods). Scale bar, 50 µm. (C) Transcriptional activity of UNK measured by a dual luciferase reporter assay at 24 hours after transfection of HeLa cells with constructs for expression of the indicated, Gal4 DNA-binding domain (Gal4)-tagged proteins. VP16 transcriptional activator served as a positive control. (–), Gal4 alone; RLU, relative luminescence units (n = 6). See also . (D) Relative quantification by qPCR of firefly luciferase mRNA levels in cells, as in (C). Gal4 UAS, Gal4 upstream activating sequences (n = 3). See also . (E) Domain map of UNK (blue) indicating its RNA-binding domain (RBD), intrinsically disordered region (IDR), and a RING finger domain. The studied segments of UNK are indicated (Table S1). Amino acid conservation (green, least conserved; purple, most conserved position) and disorder confidence profile of UNK are shown below the map (Methods). DCS, disorder confidence score. (F) As in (C), transcriptional activities of Gal4-tagged truncation mutants, indicated in (E), and deletion mutants of UNK (n = 3). See also Table S1. (G) As in (A) and (B), morphologies of cells co-expressing the indicated UNK mutant and GFP were quantified by calculating their axial ratios (y/x; Methods) (n = 50 GFP-expressing cells per cell line). (H) Correlation of cell morphologies shown in (G) with transcriptional activities of the corresponding Gal4-tagged UNK mutants shown in (F). Data in (C), (D), (F), and (G) are presented as mean ± SD. Statistical significance was determined using Student’s t-test with *p < 0.0001; ns, not significant.

Article Snippet: All other full-length UNK residue mutants, including 11DE-A, 10FY-A, 7KH-A, and E8 (Table S1), were created by replacing IDR WT in pENTR-UNK with corresponding mutant IDRs synthesized as GeneArt Strings DNA fragments (Thermo Fisher Scientific).

Techniques: Variant Assay, Incubation, Expressing, Activity Assay, Luciferase, Reporter Assay, Transfection, Construct, Binding Assay, Positive Control, Quantitative Proteomics, RNA Binding Assay, Mutagenesis

Journal: bioRxiv

Article Title: A paradigm for regulation at the effector interface with RNA-binding proteins

doi: 10.1101/2023.09.20.558714

Figure Lengend Snippet: (A) Key truncation mutants of IDR (top blue line) that led to the identification of the smallest transcriptionally active regions, minN and minC. Highly active fragments are in blue, weakly active in light blue, and silent fragments are in black. Positions of hydrophobic residues (I, L, V, M, W, F) and Y are shown in green and acidic residues (D, E) are in red. Green arrows indicate mutations that silence minN (L522A) or minC (W622A and F625A combined). PAM2, the predicted PABPC-binding motif. See also Table S1 and . (B) Dual luciferase reporter assay of Gal4 DNA-binding domain (Gal4)-fusions with IDR or its truncation mutants shown in (A) (n = 3). (–), Gal4 alone; RLU, relative luminescence units. (C) Contribution of different residues to the transcriptional activity of Gal4-tagged IDR. The indicated mutants were analyzed as in (B). ‘All-type mutants’ have all residues of the indicated type mutated to alanines (n = 3). See also Table S1. (D) Contribution of the indicated mutations to the transcriptional activity of the Gal4-tagged full-length UNK, analyzed as in (B) (n = 3). See also Table S1. (E) Morphologies of cells inducibly co-expressing the indicated full-length UNK mutant and GFP at 48 h of incubation with Dox (n = 50 GFP-expressing cells per cell line). (F) Correlation of cell morphologies shown in (E) with transcriptional activities shown in (D) for the indicated mutants. Data in (B)-(E) are presented as mean ± SD. Statistical significance was determined using Student’s t test with *p < 0.0001; ns, not significant.

Article Snippet: All other full-length UNK residue mutants, including 11DE-A, 10FY-A, 7KH-A, and E8 (Table S1), were created by replacing IDR WT in pENTR-UNK with corresponding mutant IDRs synthesized as GeneArt Strings DNA fragments (Thermo Fisher Scientific).

Techniques: Binding Assay, Luciferase, Reporter Assay, Activity Assay, Expressing, Mutagenesis, Incubation

Journal: bioRxiv

Article Title: A paradigm for regulation at the effector interface with RNA-binding proteins

doi: 10.1101/2023.09.20.558714

Figure Lengend Snippet: (A) Principle of a dual luciferase reporter assay used to detect transcriptional activity of UNK. A tested protein (X) is tagged with the Gal4 DNA-binding domain for recruitment via Gal4 upstream activating sequences (Gal4 UAS) to the adenovirus major late promoter (Ad) driving minimal expression of the firefly luciferase reporter gene. The thymidine kinase (TK) promoter-driven Renilla luciferase serves as an internal control (Methods). (B) Endogenous UNK detected by immunofluorescence using UNK-specific antibody in SH-SY5Y human neuroblastoma cells stably expressing either shRNA targeting luciferase (Control shRNA, top) or UNK (bottom). Scale bar, 10 μm. (C) Ectopic Flag-HA-tagged UNKWT or UNK3M (D) detected by immunofluorescence using an HA-specific antibody in inducible HeLa cells treated with doxycycline for 24 h. Scale bar, 10 μm. DAPI was used to visualize nuclei. Confocal images shown in (B) and (C) are representative of n ≥ 3 experiments.

Article Snippet: All other full-length UNK residue mutants, including 11DE-A, 10FY-A, 7KH-A, and E8 (Table S1), were created by replacing IDR WT in pENTR-UNK with corresponding mutant IDRs synthesized as GeneArt Strings DNA fragments (Thermo Fisher Scientific).

Techniques: Luciferase, Reporter Assay, Activity Assay, Binding Assay, Expressing, Control, Immunofluorescence, Stable Transfection, shRNA

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Plastid production of protein antibiotics against pneumonia via a new strategy for high-level expression of antimicrobial proteins

doi: 10.1073/pnas.0813146106

Figure Lengend Snippet: Plastid transformation with pTox vectors. (A) Physical maps of the targeting region in the wild-type plastid genome and the transgenic plastid genomes in transplastomic Nt-pTox-GFP, Nt-pTox-Pal, and Nt-pTox-Cpl-1 lines. Relevant restriction sites used for cloning and RFLP analysis of transplastomic lines are marked. Sizes of expected restriction fragments in RFLP analyses are indicated. The location of the RFLP probe is shown as black bar. (B) RFLP analysis of transplastomic lines. Total DNA was digested with HincII and hybridized to a probe detecting the region of the plastid genome that flanks the transgene insertion site. Fragment sizes are indicated in kb. Transplastomic lines before (selfed) and after (Cre) elimination of the aadA marker and the transcription block are compared. Numbers of independently-generated transplastomic lines and individually-regenerated plants (capital letters) are indicated above the blot. Faint wild-type-like bands in all transplastomic lines are caused by promiscuous DNA in the nucleus, as shown (30). (C) Identification of leaf sectors lacking the aadA marker by germination of seedlings on spectinomycin-containing medium. Removal of the aadA by site-specific recombination is evidenced by sectorial bleaching (arrows).

Article Snippet: A synthesized DNA fragment (GENEART) covering the rho-dependent terminator λtR1 from the cro gene of phage λ ( Trho ; ref. 14 ), the intrinsic terminator rrn B T1 from E. coli ( Tint ; ref. 15 ), a loxP site and the leader sequence from the gene 10 transcript of phage T7 ( T7G10L ; ref. 10 ; 5′-ataaccccgctcttacacattccagccctgaaaaagggcatcaaattaaaccacacctatggtgtatgcatttatttgcatacattcaatcaattgttagctttcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttaatctgataacttcgtataatgtatgctatacgaagttatggatcctagaaataattttgtttaactttaagaaggagatatacccatggaaatctaga-3′) was cloned as a SpeI–XbaI fragment into pMO22 (cut with XbaI and dephosphorylated with antarctic phosphatise; NEB), resulting in pMO23.

Techniques: Transformation Assay, Transgenic Assay, Cloning, Marker, Blocking Assay, Generated